ChordNanoe Biroe I luh suba mati - Nanoe Biroe - I Luh Sube Mati CBes amonto ban beEmli nyayangin i luh FLemah peteng beGli i luh ne ngelahang CNanging jani i luh megEmatin tresna kapining beli FUlian ragan i luhe maanG nak muani ne sugihan * AmSebet bayun Embeline FNingehang i luh Gngorang selamat tCinggal AmSakit hatiEmn beline Berikutlirik dan chord kunci gitar lagu I Luh Sube Mati - Nanoe Biroe. Anggap beli i luh suba mati Sing ada di gumine. Berikut lirik dan chord kunci gitar lagu I Luh Sube Mati - Nanoe Biroe. Anggap beli i luh suba mati Sing ada di gumine. Rabu, 13 Juli 2022; Cari. Network. Tribunnews.com; TribunnewsWiki.com; KunciGitar Nanoe Biroe - Menyama dan Lirik Lagu (Intro) Am C Am C Am C tusing merasa galah mejalan Am C mejalan nyalanang kehidupan Am C jani suba pada mekurenan Am C ngubu ditongos C rasa iraga menyama Dm asah asih asuh menyama Am nganti mati tetap menyama F ada ne sing berubah C rasa iraga menyama Dm jele melah enu menyama Chordgitar lagu / Kunci gitar lagu Nanoe Biroe - Guek - ( 2907 ) Ganti Kunci Gitar: + -Nanoe Biroe-Guek Intro : G Em C D G. Gue minum G arak, keneh-ke Em neh gue Ngudiang C el D o ne G sewot Nanoe Biroe - I luh suba mati: Nanoe Biroe - Jantung ati: Lihat kumpulan Chord gitar Nanoe Biroe Lengkap disini. NanoeBiroe - Sumpah Mati Cinta Mati [ Lirik - Chord/ Kunci Gitar ] Nanoe Biroe. Minab suba abulan Am Em. Beli setata nelponin Komang F G C G. Bilang peteng beli SMSin Komang C G . Ngorang good night Komang Am Em. Have a sweet dream, met bobok Komang 6uH3E. Nanoe biroe – Iluh suba mati Kunci Gitar & Lirik C EmBes amonto ban Beli nyayangin IluhF GLemah peteng Beli Iluh ne ngelahangC EmNanging jani Iluh megatin tresna kapining BeliF GUlian ragan Iluhe maan nak muani ne sugihan... Am EmSebet bayun Beline...F G CNingehang Iluh ngorang selamat tinggalAm EmSakit hatin Beline...F GBuduh ragan Beli jagi ngengsapang Iluh... C E/B Em FAnggap Beli Iluh suba matiGSing ada di gumine...C E/B Em FAnggap Beli Iluh sube ngalinGSing enu di gumine... Continue Reading November 25, 2020 Chord Kunci Gitar dan Lirik Lagu Nanoe Biroe - I Luh Sube MatiC EmBes amonto ban beli nyayangin i luhF GLemah peteng beli i luh ne ngelahangC EmNanging jani i luh megatin tresna kapining beliF GUlian ragan i luhe maan nak muani ne sugihan…* Am EmSebet bayun beline…F G CNingehang i luh ngorang selamat tinggalAm EmSakit hatin beline…F GBuduh ragan beli jagi ngengsapang i luh…Reff C E/B Em FAnggap beli i luh suba matiGSing ada di gumine…C E/B Em FAnggap beli i luh sube ngalinGSing enu di gumine…Musik C Em F G 4x* Am EmSebet bayun beline…F G CNingehang i luh ngorang selamat tinggalAm EmSakit hatin beline…F GBuduh ragan beli jagi ngengsapang i luh…Reff C E/B Em FAnggap beli i luh suba matiGSing ada di gumine…C E/B Em FAnggap beli i luh sube ngalinGSing enu di gumine…C E/B Em FI luuuhhhh… i luh suba matiGSing ada di gumine…C E/B Em FI luuuhhhh… i luh sube ngalinGSing enu di gumine…C EmBes amonto ban beli nyayangin i luhF GLemah peteng beli i luh ne ngelahang album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCCCCCCCCCCCCCCCCCCCCEmCCCCCCCFCCCCCCCGCCCCCCCCCCCCCCCCEmCCCCCCFCCCCCCGCCCCCCCCAmCCCCCCCEmCCCCCCCFCCGCCCCCCCCCCCCACCCCCCCEmCCCCCCCFCCCCCCGCCCCCCCCCCCCCCEmCCCCCBmCCCAmCCCEmCCCFCCCCCCCCCCCECCCCCCCBmCCCAmCCCEmCCCFCCCCCCCCCFmCCCDCACCCCCCCCmCCCCCCDCCCCCCCCECCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCAmCCCCCCCEmCCCCCCCFCCCGCCCCCCCCGCCACCCCCCCEmCCCCCCCFCCCCCCCCCCCCCCCCCCCCCCAmCCCCEmCCCFCCCCCCCCCFmCCCCCCCCCCCCCAmCCDCEmCCFCCCCCCCCGCCCCCCCCCCCCCCCCCCGCCCAmCCCEmCCCFCCCCCCCCCCCACCCCCCCGCCCAmCCCEmCCCFCCCCCCCCCCCCCCCCCCCEmCCCACCCEmCCCFCCCCCCCGCCCCCCCCCCCEmCCCACCCEmCCCFCCCCCCCCCCCCCCCFmCCCCCCCCCCCCCEmCCCCCCCFCCACCFCCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login